Sequence deleted from genome at T-DNA insertion site
CTATGATGTAAACCAACTTATCAAGATGAACTATCTTGAATAGAAAATCTTGAAATTG
Patterns of Gene Expression and links to Gene map and Transcript information
Version 5    
Version 6
Chromosome location of miR genes, hairpin structures of pre-miRNAs and links to target genes
Relates genes, transcripts and scaffold locations between Solgenomic's and our assembies.
Vectors and Designer for artificial miRNAs
Vectors and Designer for hpRNA silencing
Find sites (reduced off-target) and design constructs
Find sites (fewer) and design constructs
Find sites (more) and design constructs
pHannibal, pKannibal and pHellsgate Vectors
pBlueGreen Vector for primer designer system
p35S:PVX and pCMV Vectors
pART7 and pART27 Vectors
In-house plasmids
Quickstart H.armigera Acetylcholinesterase vs the animal spectrum
For predicting cross-silencing in Trans-Kingdom RNAi
Descriptions of wild and lab isolate collection sites and phenotypes.
Description of the site and inserted sequence of 16c isolate.
Evolution of N.benthamiana and the Suaveolentes
Meet the Relatives
Provenance of Lab Isolate
Seed of LAB and wild N.benthamiana
Time lapse movies of:
GFP-labelled virus spread
mobile silencing signal
Genome and Transcriptome Assemblies and Metrics
Genome and Transcriptome Assemblies for downloading
Details about tracks loaded onto GBROWSE and databases for BLAST.
The people (past and present) in the Consortium
Our publications about the Benth Genome and Transcriptome
Type your question or message into query box
We are at the Gardens Point Campusin Brisbane, Australia.
Email: ctcbenquiries@qut.edu.au
Phone: 07 3138 2000
Mon - Fri, 8.30am - 5pm
CTATGATGTAAACCAACTTATCAAGATGAACTATCTTGAATAGAAAATCTTGAAATTG
CRICOS No. 00213J ABN 83 791 724 622
